6.2. Protein synthesis
A subsection of Biology, 9700, through 6. Nucleic acids and protein synthesis
Listing 10 of 197 questions
Some animals produce antimicrobial proteins which protect them from pathogens. These proteins could be used to kill human pathogens, however when used as a medicine they are broken down by protein-digesting enzymes. Replacing one of the amino acids found in the protein with one that had been synthesised in the laboratory resulted in a modified protein that was not broken down. What could explain why this modified protein was not broken down by the protein digesting enzymes?
9700_w18_qp_13
MCQ
2018
Paper 1, Variant 3
View
Sickle cell anaemia is caused by a mutation in an allele of the gene that codes for the β-globin polypeptide of haemoglobin. The diagram shows the sequence of bases in a small section of the template strand of DNA for both the HbA and HbS (sickle cell) β-globin alleles. HbA CTGACTCCTGAGGAGAAGTCT HbS CTGACTCCTGTGGAGAAGTCT Both the polypeptides for HbA and HbS are the same length. How will the mutation in the allele result in the production of an altered version of the β-globin polypeptide?
9700_w23_qp_11
MCQ
2023
Paper 1, Variant 1
View
is a transmission electron micrograph showing a section of a specialised epithelial cell found in the lining of the stomach. This cell produces extracellular proteins that are released into the bloodstream. ×6000 X Y Outline the role of structure X and structure Y, as shown in , in the production of extracellular proteins. structure X structure Y The cell in releases ghrelin, a small protein that acts as a cell signalling molecule. shows the sequence of amino acids in a ghrelin molecule. The amino acid serine (Ser) in position 3 in has been modified by the addition of a saturated fatty acid chain. NH2 Gly Ser Ser Phe Leu Ser Pro Glu His Gln Arg Val Gln Gln Arg Lys Glu Ser Lys Lys Pro Pro Ala Lys Leu Gln Pro Arg COOH O O C C H H H C H H C H H C H H C H H C H H C H H State the level of protein structure shown in . State one similarity between the structure of a saturated fatty acid molecule and an amino acid molecule. The addition of the fatty acid chain allows ghrelin to function as a cell signalling molecule. Suggest how the addition of this fatty acid chain allows a ghrelin molecule to act as a cell signalling molecule. Scientists have discovered that the gene coding for ghrelin contains 5000 base pairs. This is a much larger number of base pairs than is needed to code for the ghrelin molecule shown in . Calculate the percentage of base pairs found in the gene that codes for the ghrelin molecule shown in . Show your working and give your answer to one decimal place. The primary transcript produced from the ghrelin gene is a longer molecule than the mRNA found in the cytoplasm. Explain how the primary transcript is modified before translation.
9700_w23_qp_21
THEORY
2023
Paper 2, Variant 1
View
is a diagram showing the transcription of part of the COL1A2 gene that codes for a collagen polypeptide. The part of the COL1A2 gene shown is a section of exon. Structure A represents an enzyme involved in transcription. C T C U U U T T A A G A A A T C A A G A G G T G T A A A G C T A A T C G T A C G C G A U C G A U T A T T A C T G 5' 5' 3' 3' transcribed strand non-transcribed strand primary transcript A Name the enzyme labelled A in . Name the bond that forms between the nucleotides in the primary transcript. State the number of amino acids that are coded for by the sequence of nucleotides on the primary transcript shown in . Use the information in to explain why one of the strands of DNA is not transcribed. New mitochondria are formed when a mitochondrion divides into two. is a transmission electron micrograph of a mitochondrion that is dividing. magnification ×50 000 State two features of mitochondria that are visible in . The line on shows the diameter of one of the mitochondria. Calculate the actual diameter of the mitochondrion. Give your answer to one significant figure. answer = μm Mitochondrial DNA codes for some polypeptides of proteins used within the mitochondrion. Some of the proteins allow movement of ions into and out of the mitochondria. Outline the ways in which ions can move into mitochondria.
9700_w23_qp_23
THEORY
2023
Paper 2, Variant 3
View
Questions Discovered
197